Cell Free Protein Synthesis 2014th Edition

Kirill Alexandrov pdf download

https://ebookname.com/product/cell-free-protein-synthesis-2014th-
edition-kirill-alexandrov/

Get Instant Ebook Downloads – Browse at https://ebookname.com

Instant digital products (PDF, ePub, MOBI) available
Download now and explore formats that suit you...

Solvent free Organic Synthesis opt 1st Edition Koichi

Tanaka

https://ebookname.com/product/solvent-free-organic-synthesis-
opt-1st-edition-koichi-tanaka/

Single Cell Protein Analysis Methods and Protocols 1st

Edition Anup K. Singh

https://ebookname.com/product/single-cell-protein-analysis-
methods-and-protocols-1st-edition-anup-k-singh/

Protein Based Surfactants Synthesis Physicochemical

Properties and Applications 1st Edition Jiding Xia
(Author)

https://ebookname.com/product/protein-based-surfactants-
synthesis-physicochemical-properties-and-applications-1st-
edition-jiding-xia-author/

What We Talk About When We Talk About Rape Sohaila

Abdulali

https://ebookname.com/product/what-we-talk-about-when-we-talk-
about-rape-sohaila-abdulali/
Sexuality in the Middle Ages and Early Modern Times New
Approaches to a Fundamental Cultural Historical and
Literary Anthropological Theme Albrecht Classen
(Editor)
https://ebookname.com/product/sexuality-in-the-middle-ages-and-
early-modern-times-new-approaches-to-a-fundamental-cultural-
historical-and-literary-anthropological-theme-albrecht-classen-
editor/

Tribal Architecture in Northeast India 1st Edition René

Kolkman

https://ebookname.com/product/tribal-architecture-in-northeast-
india-1st-edition-rene-kolkman/

Forever A Novel of Good and Evil Love and Hope Jude

Deveraux

https://ebookname.com/product/forever-a-novel-of-good-and-evil-
love-and-hope-jude-deveraux/

Programming Flex 2 The comprehensive guide to creating

rich media applications with Adobe Flex 1st Edition
Chafic Kazoun

https://ebookname.com/product/programming-flex-2-the-
comprehensive-guide-to-creating-rich-media-applications-with-
adobe-flex-1st-edition-chafic-kazoun/

Democratization Without Representation The Politics of

Small Industry in Mexico Kenneth C. Shadlen

https://ebookname.com/product/democratization-without-
representation-the-politics-of-small-industry-in-mexico-kenneth-
c-shadlen/
Consciousness Theatre Literature and the Arts 2013 1st
Edition Daniel Meyer-Dinkgrafe

https://ebookname.com/product/consciousness-theatre-literature-
and-the-arts-2013-1st-edition-daniel-meyer-dinkgrafe/
Methods in
Molecular Biology 1118

Kirill Alexandrov
Wayne A. Johnston Editors

Cell-Free
Protein
Synthesis
Methods and Protocols
METHODS IN M O L E C U L A R B I O LO G Y ™

Series Editor
John M. Walker
School of Life Sciences
University of Hertfordshire
Hatfield, Hertfordshire, AL10 9AB, UK

For further volumes:

http://www.springer.com/series/7651
 Cell-Free Protein Synthesis

Methods and Protocols

Edited by

Kirill Alexandrov and Wayne A. Johnston

Institute for Molecular Bioscience, The University of Queensland, St. Lucia, QLD, Australia
Editors
Kirill Alexandrov Wayne A. Johnston
Institute for Molecular Bioscience Institute for Molecular Bioscience
The University of Queensland The University of Queensland
St. Lucia, QLD, Australia St. Lucia, QLD, Australia

ISSN 1064-3745 ISSN 1940-6029 (electronic)

ISBN 978-1-62703-781-5 ISBN 978-1-62703-782-2 (eBook)
DOI 10.1007/978-1-62703-782-2
Springer New York Heidelberg Dordrecht London

Library of Congress Control Number: 2013957131

© Springer Science+Business Media, LLC 2014

This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is
concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction
on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation,
computer software, or by similar or dissimilar methodology now known or hereafter developed. Exempted from this
legal reservation are brief excerpts in connection with reviews or scholarly analysis or material supplied specifically for
the purpose of being entered and executed on a computer system, for exclusive use by the purchaser of the work.
Duplication of this publication or parts thereof is permitted only under the provisions of the Copyright Law of the
Publisher’s location, in its current version, and permission for use must always be obtained from Springer. Permissions
for use may be obtained through RightsLink at the Copyright Clearance Center. Violations are liable to prosecution
under the respective Copyright Law.
The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not
imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and
regulations and therefore free for general use.
While the advice and information in this book are believed to be true and accurate at the date of publication, neither
the authors nor the editors nor the publisher can accept any legal responsibility for any errors or omissions that may be
made. The publisher makes no warranty, express or implied, with respect to the material contained herein.

Printed on acid-free paper

Humana Press is a brand of Springer

Springer is part of Springer Science+Business Media (www.springer.com)
Preface

Advances in Life Sciences and Biotechnology have historically relied on the ability to replicate
the building blocks of life in vitro, in order to elucidate their mode of action. Much bio-
technological progress in the last 40 years has been focused on developing more efficient
analysis and synthesis technologies for both DNA and proteins. However, while orders of
magnitude reduction in costs for DNA sequencing and synthesis was achieved during the
last decade, the throughput and cost of technologies for protein production and engineer-
ing have changed comparatively little.
Cell-free protein expression is a rapid and high-throughput methodology for conver-
sion of DNA-encoded genetic information into protein-mediated biochemical activities. It
holds the promise to narrow the technological gap between DNA and protein technologies
and provide a platform for broad application of synthetic biology principles in the Life
Sciences.
Cell-free technologies have developed in two opposite but complementary directions:
scale-up and miniaturization. Scale-up aims to produce preparative amounts of high-value
recombinant proteins rapidly and without involvement of a recombinant host.
Miniaturization aims to extract the most information out of the smallest amount of the
largest possible number of proteins or protein variants at the lowest possible cost.
Combination of both directions is expected to provide us with a powerful platform for
protein analysis, engineering, and manufacturing.
This book is aimed to bring together the key opinion leaders of cell-free technology
development and provide case studies and detailed protocols for application of cell-free
methodology. The book aims to cover the main directions in the development of cell-free
technologies including several recently developed cell-free systems. The book also presents
a number of applications of cell-free systems that range from discovery of biofuel enzymes
to in vitro assembly of viruses.
Target groups: Biochemists, bioengineers, biotechnologists, cell biologists, and chemical
and synthetic biologists.

St. Lucia, QLD, Australia Kirill Alexandrov

Wayne A. Johnston

v
Contents

Preface. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v
Contributors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix

1 Production of Eukaryotic Cell-Free Lysate from Leishmania tarentolae . . . . . . 1

Wayne A. Johnston and Kirill Alexandrov
2 Bioinformatics Analysis and Optimization of Cell-Free Protein Synthesis . . . . . 17
Alexander A. Tokmakov, Atsushi Kurotani, Mikako Shirouzu,
Yasuo Fukami, and Shigeyuki Yokoyama
3 A Cell-Free Expression Screen to Identify Fusion Tags
for Improved Protein Expression. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35
Andrew Kralicek
4 One-Pot, Microscale Cell-Free Enzyme Expression and Screening. . . . . . . . . . 55
Aarthi Chandrasekaran and Anup K. Singh
5 Cell-Free Translation of Biofuel Enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71
Taichi E. Takasuka, Johnnie A. Walker, Lai F. Bergeman,
Kirk A. Vander Meulen, Shin-ichi Makino, Nathaniel L. Elsen,
and Brian G. Fox
6 Cloning-Independent Expression and Screening
of Enzymes Using Cell-Free Protein Synthesis Systems . . . . . . . . . . . . . . . . . . 97
Yong-Chan Kwon, Jae-Kwang Song, and Dong-Myung Kim
7 High-Level Cell-Free Production of Membrane
Proteins with Nanodiscs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
Christian Roos, Lei Kai, Stefan Haberstock, Davide Proverbio,
Umesh Ghoshdastider, Yi Ma, Slawomir Filipek, Xiaoning Wang,
Volker Dötsch, and Frank Bernhard
8 Cell-Free Protein-Based Enzyme Discovery
and Protein–Ligand Interaction Study. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131
Sabrina Guillemer, Cécile Persillon, Jean-Michel Masson,
and Gilles Ravot
9 Human Cell Extract-Derived Cell-Free Systems for Virus Synthesis . . . . . . . . . 149
Tominari Kobayashi, Kodai Machida, and Hiroaki Imataka
10 Cell-Free Protein Synthesis in Microfluidic 96-Well Plates . . . . . . . . . . . . . . . . 157
Kirsten Jackson, Ruba Khnouf, and Z. Hugh Fan
11 Preparation of Multiple Site-Specific Mutant Proteins
for NMR Studies by PCR-Directed Cell-Free Protein Synthesis . . . . . . . . . . . . 169
Kiyoshi Ozawa and Ruhu Qi
12 Site-Specific Incorporation of Unnatural Amino Acids
into Proteins by Cell-Free Protein Synthesis . . . . . . . . . . . . . . . . . . . . . . . . . . 189
Kiyoshi Ozawa and Choy Theng Loh

vii
viii Contents

13 In Vitro Translation of Papillomavirus Authentic and Codon-Modified

L1 Capsid Gene mRNAs in Mouse Keratinocyte Cell-Free Lysate . . . . . . . . . . 205
Kong-Nan Zhao
14 An Optimized Yeast Cell-Free Lysate System
for In Vitro Translation of Human Virus mRNA . . . . . . . . . . . . . . . . . . . . . . . 219
Xiao Wang, Liang Zhao, and Kong-Nan Zhao
15 In Vitro Translation-Based Protein Kinase Substrate Identification . . . . . . . . . 231
Szilvia K. Nagy and Tamás Mészáros
16 Preparation of Protein Arrays Using Cell-Free Protein Expression . . . . . . . . . . 245
Elizabeth A. Cook and Mingyue He
17 Posttranscriptional Control of Protein Synthesis
in Drosophila S2 Cell-Free System . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 257
Motoaki Wakiyama and Shigeyuki Yokoyama
18 Cell-Free Membrane Protein Expression . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 267
Tomomi Kimura-Soyema, Mikako Shirouzu, and Shigeyuki Yokoyama
19 The PURE System for Protein Production . . . . . . . . . . . . . . . . . . . . . . . . . . . 275
Yoshihiro Shimizu, Yutetsu Kuruma, Takashi Kanamori,
and Takuya Ueda
20 A Cell-Free Protein Synthesis System from Insect Cells . . . . . . . . . . . . . . . . . . 285
Toru Ezure, Takashi Suzuki, and Eiji Ando
21 A Cell-Free Expression Platform for Production
of Protein Microarrays . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 297
Xristo Zárate and David W. Galbraith

Errata . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . E1
Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 309
Contributors

KIRILL ALEXANDROV • Institute for Molecular Bioscience, The University of Queensland,

St. Lucia, QLD, Australia
EIJI ANDO • Analytical & Measuring Instruments Division, Clinical & Biotechnology
Business Unit, Shimadzu Corporation, Kyoto, Japan
LAI F. BERGEMAN • Department of Biochemistry, University of Wisconsin, Madison, WI, USA
FRANK BERNHARD • Centre for Biomolecular Magnetic Resonance, Institute for Biophysical
Chemistry, Goethe-University of Frankfurt/Main, Frankfurt/Main, Germany
AARTHI CHANDRASEKARAN • Joint BioEnergy Institute (JBEI), Emeryville, CA, USA;
Sandia National Laboratories, Livermore, CA, USA
ELIZABETH A. COOK • Protein Technology Group, Babraham Research Campus, Babraham
Bioscience Technologies Ltd, Cambridge, UK
VOLKER DÖTSCH • Centre for Biomolecular Magnetic Resonance, Institute for Biophysical
Chemistry, Goethe-University of Frankfurt/Main, Frankfurt/Main, Germany
NATHANIEL L. ELSEN • Department of Biochemistry, University of Wisconsin, Madison,
WI, USA
TORU EZURE • Analytical & Measuring Instruments Division, Clinical & Biotechnology
Business Unit, Shimadzu Corporation, Kyoto, Japan
SLAWOMIR FILIPEK • Faculty of Chemistry, University of Warsaw, Warsaw, Poland
BRIAN G. FOX • Department of Biochemistry, University of Wisconsin, Madison, WI, USA
YASUO FUKAMI • Graduate School of Science, Kobe University, Nada, Japan; Research
Center for Environmental Genomics, Kobe University, Nada, Japan
DAVID W. GALBRAITH • School of Plant Sciences and BIO5 Institute, University of Arizona,
Tucson, AZ, USA
UMESH GHOSHDASTIDER • Centre for Biomolecular Magnetic Resonance, Institute for
Biophysical Chemistry, Goethe-University of Frankfurt/Main, Frankfurt/Main,
Germany; Faculty of Chemistry, University of Warsaw, Warsaw, Poland
SABRINA GUILLEMER • Protéus, Parc Georges Besse, Nîmes, France
STEFAN HABERSTOCK • Centre for Biomolecular Magnetic Resonance, Institute for Biophysical
Chemistry, Goethe-University of Frankfurt/Main, Frankfurt/Main, Germany
MINGYUE HE • The Inositide Laboratory, Babraham Institute, Babraham Research
Campus, Cambridge, UK
Z. HUGH FAN • Department of Mechanical and Aerospace Engineering, University of
Florida, Gainesville, FL, USA; Department of Biomedical Engineering, University of
Florida, Gainesville, FL, USA
HIROAKI IMATAKA • Department of Materials Science and Chemistry, Graduate School of
Engineering, University of Hyogo, Himeji, Japan; Molecular Nanotechnology Research
Center, Graduate School of Engineering, University of Hyogo, Himeji, Japan; RIKEN
Systems and Structural Biology Center, Tsurumi-ku, Yokohama, Japan
KIRSTEN JACKSON • Department of Biomedical Engineering, University of Florida,
Gainesville, FL, USA

ix
x Contributors

WAYNE A. JOHNSTON • Institute for Molecular Bioscience, The University of Queensland,

St. Lucia, QLD, Australia
LEI KAI • Centre for Biomolecular Magnetic Resonance, Institute for Biophysical
Chemistry, Goethe-University of Frankfurt/Main, Frankfurt/Main, Germany
TAKASHI KANAMORI • The Department of Medical Genome Sciences, Graduate School of
Frontier Sciences, The University of Tokyo, Kashiwanoha, Kashiwa, Chiba, Japan;
GeneFrontier Corporation, Kahiwanoha, Kashiwa, Chiba, Japan
RUBA KHNOUF • Biomedical Engineering Department, Jordan University of Science
and Technology, Irbid, Jordan
DONG-MYUNG KIM • Department of Fine Chemical Engineering and Applied Chemistry,
Chungnam National University, Daejeon, South Korea
TOMOMI KIMURA-SOYEMA • RIKEN Systems and Structural Biology Center, Tsurumi,
Yokohama, Japan
TOMINARI KOBAYASHI • Department of Materials Science and Chemistry, Graduate School of
Engineering, University of Hyogo, Himeji, Japan
ANDREW KRALICEK • The New Zealand Institute for Plant & Food Research Limited,
Auckland, New Zealand
ATSUSHI KUROTANI • • RIKEN Systems and Structural Biology Center, Yokohama, Japan;
Plant Science Center, Yokohama, Japan; Department of Biotechnology and Life Science,
Tokyo University of Agriculture and Technology, Tokyo, Japan
YUTETSU KURUMA • The Department of Medical Genome Sciences, Graduate School of
Frontier Sciences, The University of Tokyo, Kashiwa, Chiba, Japan
YONG-CHAN KWON • Department of Fine Chemical Engineering and Applied Chemistry,
Chungnam National University, Daejeon, South Korea
CHOY THENG LOH • Research School of Chemistry, Australian National University,
Canberra, ACT, Australia
YI MA • Centre for Biomolecular Magnetic Resonance, Institute for Biophysical Chemistry,
Goethe-University of Frankfurt/Main, Frankfurt/Main, Germany; School of Bioscience
and Bioengineering, South China University of Technology, Guangzhou,
People’s Republic of China
KODAI MACHIDA • Department of Materials Science and Chemistry, Graduate School of
Engineering, University of Hyogo, Himeji, Japan; Molecular Nanotechnology Research
Center, Graduate School of Engineering, University of Hyogo, Himeji, Japan
SHIN-ICHI MAKINO • Department of Biochemistry, University of Wisconsin, Madison,
WI, USA
JEAN-MICHEL MASSON • Protéus, Parc Georges Besse, Nîmes, France
TAMÁS MÉSZÁROS • Department of Medical Chemistry, Molecular Biology and
Pathobiochemistry, Semmelweis University, Budapest, Hungary
SZILVIA K. NAGY • Department of Medical Chemistry, Molecular Biology and
Pathobiochemistry, Semmelweis University, Budapest, Hungary
KIYOSHI OZAWA • School of Chemistry, University of Wollongong, Wollongong, NSW,
Australia
CÉCILE PERSILLON • Protéus, Parc Georges Besse, Nîmes, France
DAVIDE PROVERBIO • Centre for Biomolecular Magnetic Resonance, Institute for Biophysical
Chemistry, Goethe-University of Frankfurt/Main, Frankfurt/Main, Germany
RUHU QI • Research School of Chemistry, Australian National University, Canberra,
ACT, Australia
GILLES RAVOT • Protéus, Parc Georges Besse, Nîmes, France
 Contributors xi

CHRISTIAN ROOS • Centre for Biomolecular Magnetic Resonance, Institute for Biophysical
Chemistry, Goethe-University of Frankfurt/Main, Frankfurt/Main, Germany
YOSHIHIRO SHIMIZU • Laboratory for Cell-Free Protein Synthesis, Quantitative Biology
Center, RIKEN, Chuo-ku, Kobe, Hyogo, Japan
MIKAKO SHIROUZU • RIKEN Systems and Structural Biology Center, Tsurumi,
Yokohama, Japan
ANUP K. SINGH • Biotechnology and Bioengineering Department, Joint BioEnergy Institute,
Sandia National Laboratories, Livermore, CA, USA
JAE-KWANG SONG • Korea Research Institute of Chemical Technology, Daejeon, South Korea
TAKASHI SUZUKI • 1 Nishinokyo Kuwabaracho, Nakagyo, Kyoto, Japan
TAICHI E. TAKASUKA • Department of Biochemistry, University of Wisconsin, Madison,
WI, USA
ALEXANDER A. TOKMAKOV • RIKEN Systems and Structural Biology Center, Tsurumi,
Yokohama, Japan; Graduate School of Science, Kobe University, Nada, Japan; Research
Center for Environmental Genomics, Kobe University, Nada, Japan
TAKUYA UEDA • The Department of Medical Genome Sciences, Graduate School of Frontier
Sciences, The University of Tokyo, Kashiwanoha, Kashiwa, Chiba, Japan
KIRK A. VANDER MEULEN • Department of Biochemistry, University of Wisconsin,
Madison, WI, USA
MOTOAKI WAKIYAMA • RIKEN Systems and Structural Biology Center, Tsurumi,
Yokohama, Japan
JOHNNIE A. WALKER • Department of Biochemistry, University of Wisconsin, Madison,
WI, USA
XIAO WANG • Department of Pathology, Shandong University School of Medicine, Jinan,
People’s Republic of China
XIAONING WANG • School of Bioscience and Bioengineering, South China University of
Technology, Guangzhou, People’s Republic of China
SHIGEYUKI YOKOYAMA • RIKEN Systems and Structural Biology Center, Yokohama, Japan;
Department of Biophysics and Biochemistry, Graduate School of Science, The University of
Tokyo, Bunkyo-ku, Tokyo, Japan
XRISTO ZÁRATE • Universidad Autonoma de Nuevo Leon, UANL, Facultad de Ciencias
Quimicas, Av. Universidad S/N, Ciudad Universitaria, San Nicolas de los Garza,
Nuevo Leon, Mexico
KONG-NAN ZHAO • UQ Centre for Clinical Research, The University of Queensland,
Herston, Brisbane, QLD, Australia; Institute of Molecular Virology and Immunology,
Wenzhou Medical College, Wenzhou, Zhejiang, People’s Republic of China
LIANG ZHAO • Division of Molecular Genetics and Development, Institute for Molecular
Bioscience, The University of Queensland, Brisbane, QLD, Australia
 Chapter 1

Production of Eukaryotic Cell-Free Lysate

from Leishmania tarentolae
Wayne A. Johnston and Kirill Alexandrov

Abstract
In this chapter, we describe the production and application of a eukaryotic cell-free expression system
based on Leishmania tarentolae. This single-celled flagellate allows straightforward and inexpensive culti-
vation in flasks or bioreactors. Unlike many other Leishmania species, it is nonpathogenic to humans and
does not require special laboratory precautions. An additional reason it is a convenient source organism for
cell-free lysate production is that all endogenous protein expression can be suppressed by a single antisense
oligonucleotide targeting splice leader sequence on the 5′-end of all protein coding RNAs. We describe
simple procedures for cell disruption and lysate processing starting from bioreactor culture. We also
describe introduction of genetic information via vectors containing species-independent translation initia-
tion sites (SITS). We consider that such an inexpensive eukaryotic cell-free production system has many
advantages when expressing multi-subunit proteins or difficult to express proteins.

Key words Leishmania tarentolae, Fluorophores, Nitrogen cavitation, Eukaryote, Bioreactors, SITS,
Overlap/extension PCR, mCherry, eGFP

1 Introduction

Decades ago, eukaryotic cell-free protein expression systems

played a primary role in the discovery of the genetic code. However,
present-day advances in eukaryotic cell-free expression are still rel-
evant due to issues of quality in the commonly used E. coli cell-free
lysates and problems with cost and complexity in existing eukary-
otic cell-free systems. Specifically, the advantages of low cost, scal-
ability, and high productivity by the prokaryotic E. coli-based
cell-free system are offset by problems in producing multi-domain
proteins in active form, as well as supporting their assembly into
complexes. A number of eukaryotic cell-free systems have been
made commercially available, specifically Wheat Germ Extract
(WGE), Rabbit Reticulocyte Lysate (RRL), Insect Cell Lysate
(ICE), and HeLa cell lysate (HCL). Although these eukaryotic
cell-free systems perform better than E. coli cell-free lysate in

Kirill Alexandrov and Wayne A. Johnston (eds.), Cell-Free Protein Synthesis: Methods and Protocols, Methods in Molecular Biology,
vol. 1118, DOI 10.1007/978-1-62703-782-2_1, © Springer Science+Business Media, LLC 2014

1
2 Wayne A. Johnston and Kirill Alexandrov

multi-domain protein folding, their production remains complex

and expensive. Hence the challenge remains to develop a cheap
and scalable eukaryotic cell-free system.
A promising eukaryotic organism that serves as a source for
such a cell-free system is the unicellular flagellate Leishmania taren-
tolae, primarily due to two complementary characteristics. Firstly,
in promastigote form it is not only suitable for flask-based cultiva-
tion in an inexpensive media but can also be grown in bioreactor
format for maximal productivity. A second advantage is the
presence of identical splice leader sequences on all endogenous
mRNAs. These can be targeted by a single antisense oligonucle-
otide, allowing near-complete suppression of endogenous mRNA
translation [1]. Although the best-studied species Leishmania
major is a major source of human disease, L. tarentolae infects only
the moorish gecko (Tarentolae mauritanica), and hence it can be
cultivated without special precautions in laboratory environments.
It is already widely used as a transgenic organism for in vivo protein
expression [2].
In order to facilitate the development of cell-free systems,
Mureev et al. reported the design of universal sequences based on
polymeric RNA structures that facilitate translational initiation.
These species-independent translation sequences (SITS) are appli-
cable to all eukaryotic cell-free systems but have proved very suit-
able for introducing genetic information into the Leishmania
cell-free lysate system [3].
The Leishmania cell-free system has proved useful in isolating
a nearly complete complement of Rab GTPases [4] and has been
used to de-orphanize putative translation initiation factors and
phosphatases from the original host organism [5]. Current work is
focused on the integration of the Leishmania cell-free system with
microfluidic-based single molecule spectroscopy, using labeled
proteins to map multi-domain protein interaction networks.
This chapter describes the technique for cultivation and dis-
ruption of the host organism, lysate preparation, and supplementa-
tion for coupled transcription/translation protein expression. We
also provide details for template preparation based on plasmid or
overlap/extension PCR-based synthesis.

2 Materials

2.1 Manufacture of 1. Actively maintained L. tarentolae promastigote cultures

Leishmania Cell-Free (see Note 1).
Lysate 2. Filter sterilized Terrific broth medium (TB): Bacto-tryptone
12 g/L, yeast extract 24 g/L, glycerol 8 mL/L, glucose
1 g/L, KH2PO4 2.31 g/L, K2HPO4 2.54 g/L (see Note 2).
Production of Eukaryotic Cell-Free Lysate from Leishmania tarentolae 3

3. Sterile penicillin/streptomycin mix for cell culture (5,000 U/

mL penicillin, 5,000 μg/mL streptomycin, or similar). Add to
TB medium at 0.2 % v/v just prior to use (see Note 3).
4. Filter sterilized 0.25 % v/v hemin in 50 % v/v triethanolamine
(suggested bovine-derived hemin, e.g., Sigma H5533). Add
to TB medium at 0.5 % v/v just prior to use.
5. Disposable sterile tissue culture flasks of 50 mL capacity.
6. Baffled glass sterile culture flasks of 5 L (maximum) capacity,
for use with 1 L cultures.
7. Shaking incubator suitable for all flasks above.
8. Laboratory scale bioreactor with temperature, pH, and dis-
solved oxygen control (optional, if desired all cultivations can
be done in 5 L flasks as above).
9. 1.5 mL microcentrifuge tubes.
10. Microcentrifuge.
11. Bench centrifuge capable of spinning desired total Leishmania
production culture (10 L suggested) at 2,500 × g.
12. Centrifuge capable of 10,000 × g and 30,000 × g spins and cen-
trifuge tubes of sufficient strength to suit.
13. Sucrose elution buffer (SEB): 45 mM HEPES–KOH pH 7.6,
250 mM sucrose,100 mM KOAc, 3 mM Mg(OAc)2.
14. Elution buffer (EB): as SEB but without sucrose.
15. Calibrated pH probe.
16. Vacuum receiver flask of approximately 250 mL capacity.
17. Compressed nitrogen (high purity grade).
18. PD-10 Superdex 25 columns (GE Healthcare).
19. Nitrogen cavitation cell disrupter (suggested Parr Industries
model 4635 or 4639).
20. Components of 5× coupled transcription/translation feeding
solution (5×FS): 6 mM ATP, 0.68 mM GTP, 22.5 mM
Mg(OAc)2, 1.25 mM spermidine, 10 mM DTT, 200 mM cre-
atine phosphate, 100 mM HEPES-KOH pH 7.6, 5 % (v/v) PEG
3000, protease inhibitor at 5× recommended concentration
(suggested Complete™ EDTA-free, Roche), 0.68 mM of each
amino acid, 2.5 mM rNTP mix (ATP, GTP, UTP, and CTP),
0.05 mM anti-splice leader DNA oligonucleotide; sequence
CAATAAAGTACAGAAACTGATACTTATATAGCGTT (see
Note 4), 0.5 mg/mL T7 RNA polymerase, 200 U/mL creatine
phosphokinase.
21. Liquid nitrogen.
4 Wayne A. Johnston and Kirill Alexandrov

Table 1
Nonspecific primers required for OE-PCR creation of cell-free expression templates

SITS 5′-GGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAA
fragment CAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAT
ACGACTCACTATAGGGACATCTTAAGTTTATTTTATTTTATTTTATTTTATTTTAT
TTTATTTTATTTTATTTTATTTTATTTTATTTAACCATGACAGTAATGTATAAAGT
CTGTAAAGACATTAAACACGTAAGTGA-3′
Primer-F2 5′-GGGTTATTGTCTCATGAGCGG-3′

2.2 Creation For overlap/extension PCR based on genes of interest, it is neces-

of Templates for sary to design primers based on the ORFs themselves as described
Expression in in Subheading 3.4. Availability of standard primer synthesis ser-
Leishmania Cell-Free vices is required. Additional primers general to all ORFs are
System required as per Table 1.

2.3 Expression 1. Apparatus and materials for SDS-PAGE gel analysis of

and Visualization expressed proteins.
of Proteins 2. (Optional) FluoroTect™ GreenLys in vitro Translation Labeling
System (Promega) for incorporating BODIPY®-FL fluores-
cent label into expressed proteins.
3. (Optional) Incubating fluorescence plate reader capable of
measuring typical label fluorophores during expression.
4. (Optional) Gel fluorescent scanner capable of measuring typi-
cal label fluorophores (eGFP, mCherry, BODIPY®-FL).

3 Methods

3.1 Culture of Maintenance cultures (50 mL in tissue culture flasks, 74 rpm

L. tarentolae for inclined agitation, 26.5 °C) are kept in exponential growth phase
Maintenance and (doubling time 6–7 h) at the approximate concentration range
Production of 0.1–1.5 × 108 cells/mL, via suitable dilutions in fresh TB (plus
Fermentation hemin and antibiotics) every 2–3 days. An alternative is to track
Inoculum culture density as OD600, with the maintenance range approxi-
mately 0.25–0.4. Routine biomass measurements may also be
taken as OD600 values and converted to cells/mL counts via a
standard curve (see Notes 5 and 6).
For creating a Leishmania inoculum suitable for the cell-free
lysate production culture, maintenance cultures are expanded suc-
cessively over two 24 h periods in TB medium supplemented with
hemin and antibiotics. Typical dilutions are 20–200 mL (4 × 50 mL
tissue culture flasks) and 200 mL to 2 L (2× baffled 5 L flasks with
1 L fill) at 26.5 °C, 74 rpm agitation.
 Production of Eukaryotic Cell-Free Lysate from Leishmania tarentolae 5

3.2 Culture of Two methods are described for Leishmania lysate production
Leishmania for culture. Firstly, batch culture in 5 L culture flasks filled with 1 L
Cell-Free Lysate medium per flask and secondly, small-scale bioreactor culture (10 L
Production total or similar).
For batch culture in flasks, cultures are expanded into 10 × 1 L
flask and grown overnight (26.5 °C, 74 rpm agitation) for 14 h.
The target harvest cell density is approximately OD600 = 5.0 (cor-
responding to approximately 2.0 × 108 cells/mL). A suitable
inoculum cell density can be calculated from Monod growth kinet-
ics and a doubling time of 6 h at 26.5 °C (see Note 7).
For batch culture in bioreactors, inoculum density can be cal-
culated as above but with reduced doubling time of 9 h, to com-
pensate for slower growth at the altered temperature profile used.
Bioreactor parameters:
Aeration: 1vvm with compressed air, oxygen controller set to 10 %
of air saturation (see Note 8).
pH control: control pH to pH7.4 with 1 M HCl and 1 M NaOH
(see Note 9) added via automatic pumping (generally only acid
addition will be required).
Temperature control: maintain 26.5 °C for the first hour after
inoculation, then reduce temperature set point to 24 °C
(see Note 10).
Harvest time is predicted using the desired final biomass level (sug-
gested OD600 = 5.0) via formula, with bioreactor sampling to
verify actual reactor biomass close to predicted harvest time.

3.3 Production 1. Harvested cells are pelleted by centrifugation at 2,500 × g, with

of Cell-Free Lysate spent medium removed by careful decantation (see Note 11).
2. Add SEB at 4 °C (see Note 12) for washing (approximately
20× pellet volume is sufficient; pellet resuspensions can be
pooled as appropriate to reduce the number of centrifuge
tubes in each washing step). Carefully resuspend the pellet via
gentle mixing and pipetting of SEB against the cell pellet (but
not directly pipetting the pellet up and down), then spin
2,500 × g for 10 min and decant.
3. Repeat previous washing step.
4. Carefully resuspend the twice-washed Leishmania pellet in the
minimum volume of 4 °C SEB required for resuspension.
5. Remove and spin down a test volume (1.0 mL) of the concen-
trated Leishmania suspension in a 1.5 mL microcentrifuge tube
at 2,500 × g for 10 min (see Note 13). Record initial weight of the
filled tube. Remove supernatant as carefully and completely as
possible. Reweigh tube with pellet only; calculate tube difference
(from initial weight) to obtain the weight of supernatant removed.
6 Wayne A. Johnston and Kirill Alexandrov

Assuming supernatant density to be 1.0 g/mL, calculate

supernatant volume in mL. Finally, calculate the ratio of pellet
volume to total volume in the Leishmania cell concentrate as 1.0
mL supernatant volume/1.0. This ratio is typically 0.6 v/v.
6. Dilute the remaining concentrated Leishmania suspension to
a volumetric ratio of 0.38 v/v (see Note 14) with additional
addition of SEB, based on the volumetric ratio derived in the
previous step.
7. The 0.38 v/v cell suspension is disrupted using a precooled
nitrogen cavitation device (70 bar nitrogen, 45 min equilibra-
tion time prior to disruption at 4 °C). Care must be taken to
“fire” the disruption device into a precooled, thick-walled ves-
sel (see Note 15). A vacuum receiver flask is suitable.
8. Spin disrupted cell suspension at 10,000 × g at 4 °C for 20 min.
Carefully remove 2/3 of the supernatant and transfer to a
fresh centrifuge tube of suitable mechanical strength for
30,000 × g.
9. Spin at 30,000 × g at 4 °C for 20 min. Carefully remove 2/3 of
the supernatant (see Note 16).
10. Remove sucrose from the 30,000 × g supernatant by gel filtra-
tion on PD-10 Superdex 25 columns (GE Healthcare) into
fresh elution buffer minus sucrose (EB; 45 mM HEPES–KOH
pH 7.6, 100 mM KOAc, 3 mM Mg(OAc)2) at 4 °C.
11. Supplement the lysate with 5×FS (concentrated feeding solu-
tion containing the necessary cofactors and enzymes for cou-
pled transcription and translation). Four volumes of feeding
solution are mixed with 10 volumes of gel-filtered lysate, with
quantities scaled as required (see Note 17). The resulting 14
volumes represent sufficient supplemented lysate for 20 vol-
umes of total final reaction volume. Magnesium concentration
of the 5×FS may need to be varied (see Note 18). It is also
possible to directly freeze the unsupplemented lysate from gel
filtration and add feeding solution after thawing, just prior to
starting protein expression reactions.
12. The supplemented lysate is aliquoted, snap-frozen in liquid
nitrogen, and stored at −80 °C.

3.4 Construction of In vitro translation using the Leishmania cell-free extract requires
DNA Templates for preparation of template DNA with both the T7 promoter and
Coupled Transcription/ species-independent translation initiating sequence (SITS). The
Translation in the SITS (Fig. 1) includes a polymeric unstructured region upstream
Leishmania Cell-Free of the start codon and a three-hairpin structure downstream of the
System start codon. The SITS is analogous to the Internal Ribosome Entry
Site (IRES) in other cell-free systems. Although developed for the
Leishmania cell-free system, it is species independent and can be
used for expression in other pro- and eukaryotic cell-free protein
Production of Eukaryotic Cell-Free Lysate from Leishmania tarentolae 7

Fig. 1 Structure of SITS in mRNA. Template for this structure is appended to DNA
ORFS of interest for coupled transcription translation in the Leishmania cell-free
system

expression systems [3]. It should be noted that the translation of

the added sequence downstream of the start codon results in the
addition of 17 amino acids to the N′ terminus of the target
protein.
Provided the SITS and T7 promoter are present, the system
can be programmed with either linear template prepared via
overlap/extension PCR (OE-PCR) [6] or plasmid-based template.
The OE-PCR method is rapid and flexible and allows rapid genera-
tion of large protein libraries directly from unpurified PCR prod-
ucts. However, a plasmid-based approach is recommended for
high yield/high volume expressions and for open reading frames
longer than 2,500 bp. A suitable candidate plasmid for Leishmania
cell-free expression is pLTE (see Note 19).
The steps for generating OE-PCR-based templates for expres-
sion are summarized in Fig. 2 and proceed as follows:
1. Design an ORF gene-specific forward primer with 5′ adapter
sequence as shown in Fig. 2b (Primer F1) along with a reverse
primer annealing 100–150 bp 3′ of the target ORF stop codon
of the donor construct (Primer R1). It is possible to introduce
a new stop codon for C-terminal truncations at this point
(see Note 20).
2. PCR amplify the donor template with Primer F1 and R1, thus
fusing the ORF to the 5′ adapter sequence for subsequent
OE-PCR. Assemble the PCR reaction in 50 μL using high-
fidelity DNA polymerase using 1 ng/μL template, primer con-
centration 250 μM primer, and 35 cycles.
3. For the OE-PCR, combine the unpurified product from the
previous step PCR, SITS fragment, Primer F2, and Primer R1
in the quantities listed in Table 2. Sulfate-free PCR reaction
buffer is recommended as it allows direct transcription/
translation from the crude OE-PCR product. Thermal condi-
tions for the OE-PCR reaction are provided in Table 3.
4. Use gel electrophoresis to determine whether the linear DNA
template constructed in OE-PCR is of appropriate size.
8 Wayne A. Johnston and Kirill Alexandrov

Fig. 2 Schematic representation of overlap/extension PCR construction of templates for Leishmania cell-free
expression

Table 2
OE-PCR reaction mixture

Reagent Stock concentration Final concentration Volume for 50 μL

Water To 50 μL
PCR buffer 10× 1× 5 μL
dNTPs 10 mM 0.2 mM 1 μL
Primer F2 10 μM 0.5 μM 2.5 μL
Primer R1 10 μM 0.5 μM 2.5 μL
Completed first PCR 1× 0.05× 2.5 μL
SITS fragment 95 nM 5 nM 2.6 μL
Taq DNA polymerase 5 U/μL 2.5 U/100 μL 0.25 μL
 Production of Eukaryotic Cell-Free Lysate from Leishmania tarentolae 9

Table 3
OE-PCR reaction conditions

Cycle step Temp (°C) Time # Cycles

Initial denaturation 95 3 min 1
Denaturation 94 30 s 30
Annealing 50 30 s
Extension 72 1 min per kb
Final extension 72 5 min 1

Appropriate size will depend on the size of the ORF, i.e.,

~ORF + 243 bp (SITS fragment) + 100 bp (depending on
Primer R1 design).

3.5 Expression and In the author’s laboratory, expression of target proteins is typically
Visualization of carried out in N- or C-terminal fusion with fluorescent domains.
Proteins Using the Typically used are enhanced GFP (eGFP), superfolder GFP
Leishmania Cell-Free (sfGFP), or mCherry. Additionally, BODIPY®-FL can be included
System in cell-free expressions to visualize bands on SDS-PAGE gels and
determine whether expressed proteins are of correct size.
1. Thaw an aliquot of supplemented lysate and keep on ice until
added to a reaction (see Note 21).
2. Add template and sterile polished water. For a final reaction
volume of 20 μL, the additions are 14 μL supplemented lysate
plus 6 μL of DNA templates and water. For plasmid-based
templates, an optimal DNA concentration is 20 nM (see Note
22). If using crude mixture from OE-PCR, use 2–4 μL of
template. Include a negative control with no template
(see Note 23).
3. Incubate for 3 h at 27 °C. If expressing using a fluorophore
reporter and in an incubating fluorescence reader, the reaction
can be terminated when expression of reporter gene (e.g.,
eGFP) indicates the cessation of protein production (excita-
tion at 488 nm, emission at 507 nm for eGFP).
4. Visualize on an SDS-PAGE gel with suitable size markers. If
samples are unboiled, fluorophores in fusion proteins can be
directly visualized on the gel by fluorescence scanning; pro-
vided samples are not heated prior to gel loading. If using
BODIPY®-FL labeling, all expressed bands can be seen regard-
less of heating (see Note 24). An example of SDS-PAGE visu-
alization of expressed fusion proteins with and without heating
and BODIPY®-FL labeling is presented in Fig. 3.
10 Wayne A. Johnston and Kirill Alexandrov

Fig. 3 Expression of Sorting Nexin 1 (Snx1) in the Leishmania cell-free system, visualized via SDS-PAGE gel.
Snx1 was C-terminally labeled with the mCherry fluorophore. mCherry fluorescence is visualized in the red
channel, BODIPY®-FL in the green channel. Lanes A, B, and C represent three Leishmania cell-free lysates of
varying concentration. No heat represents direct loading of reaction plus SDS-PAGE loading buffer onto the gel,
in the absence of BODIPY®-FL labeling (i.e., mCherry fluorophore visible only). No heat + Bodipy represents
both fluorophore and total protein productions. 98 °C + Bodipy represents total protein production only (heat
linearized protein/destroyed fluorophore). The 98 °C linearized protein versus unheated protein migrates at
different speeds due to the presence of folded fluorophore in the latter case, both can be seen simultaneously
in the No heat + Bodipy lanes as some fluorophore linearizes on the gel even in the absence of heating in
completed expressions

4 Notes

1. Culture of L. tarentolae may be covered by local regulations

relating to quarantine. Cultures maintain viability with stan-
dard methods of glycerol freezing and −80 °C storage, and
such frozen cultures can be transferred between laboratories
on dry ice.
2. Medium components, particularly yeast extract and tryptone,
should be of the highest grade available. Leishmania growth
rate, cell size, and final lysate quality can be adversely affected
by the lower quality of complex media components.
3. The addition of antibiotics to reduce bacterial contamination
of Leishmania cultures is not strictly necessary but is recom-
mended as it does not appear to reduce cell-free lysate quality.
Production of Eukaryotic Cell-Free Lysate from Leishmania tarentolae 11

Leishmania can be routinely passaged for lysate production

over months, and antibiotic addition reduces the chances of
contamination during this time.
4. In Leishmania spp., all endogenous mRNA messages carry
identical leader sequence. Anti-splice leader oligonucleotide
blocks translation of endogenous mRNAs and consequently
allows expression exclusively of the desired exogenous mes-
sage in the cell-free lysate [3].
5. Dilution of Leishmania OD readings to the instrument linear
range (typically <0.3) should be done in fresh TB (including
hemin), as dilution of cultures into distilled water or phosphate-
buffered saline (PBS) alters cell morphology which markedly
change relationship between cells/mL and OD600.
6. Accurate quantification of Leishmania biomass at cell disrup-
tion is critical for high-quality cell-free lysate production,
much more so for routine cell dilution for maintenance cul-
tures. Hemocytometer-based cell counts on diluted culture
give a high variation between individual counts and are not
recommended for routine cell density tracking. It is sug-
gested to create an OD600 versus cell count standard curve
using triplicate (or more) counts at several cell concentra-
tions and use the standard curve to calculate cell count
from OD600.
7. Duration of the production culture should not be extended to
significantly longer than 14 h, as quality of the lysate was dem-
onstrated to deteriorate using 24 h production cultures.
8. Leishmania cultivation for cell-free lysate is grown to lower
biomass densities than bacterial cultures, and hence oxygen-
ation demand is lower. Although the sheer force transmitted
by conventional Rushton turbines (typical bacterial bioreactor
impellor type) can damage Leishmania cells and result in bio-
mass loss, rpm levels can be kept low in the oxygen control
loop thus avoiding such cell damage. It is recommended to set
minimum stirring speed for the bioreactor oxygen control
loop to zero (mixing by air lift from sparging only) and set
maximum stirring rate to not greater than 150 rpm.
9. Use of ammonium hydroxide for pH control (typically used
for bacterial bioreactor cultures in order to replenish dissolved
nitrogen used during growth) is not recommended as it results
in lower final lysate quality.
10. Reducing the temperature set point after 1 h cultivation can
be considered optional but has been demonstrated to increase
the activity of resulting lysate.
11. The typical cell pellet is quite loose and requires very careful
decantation to avoid cell loss with the discarded supernatant.
12 Wayne A. Johnston and Kirill Alexandrov

12. All steps once Leishmania culture is removed from incubation

should be done at 4 °C, either in a suitable cold room or alter-
nately with all stock solutions and cell suspensions in water-
ice-containing trays on the lab bench. All lysate preparation
steps should be followed without delays.
13. Clip the end of a 1 mL pipette tip to allow precise aspiration
of viscous 1 mL concentrated cell suspension.
14. The suggested cell suspension dilution (0.38 v/v) was derived
by empirical optimization using GFP reporter and may be
altered based on individual optimization if desired. The volu-
metric ratio optimum is narrow, with lysate activity dropping
rapidly with both less and more concentrated cell suspensions
(unpublished data).
15. Take care not to place the nitrogen cavitation device exit tube
adjacent to but not directly inside the receiver flask opening,
to avoid flask breakage or loss of disrupted cells from the vessel
via the nitrogen gas pressure wave.
16. For good lysate activity it is critical to avoid taking the unclari-
fied zone just above the supernatant/pellet interface after the
30,000 × g spin, even if this requires removing less than 2/3 of
the supernatant as usable cell lysate.
17. A typical small-scale reaction volume is 20 μL in a 384-well
plate, comprising 14 μL supplemented lysate (i.e., 10 μL lysate
plus 4 μL 5×FS), with 6 μL additional volume which will con-
tain the DNA template for coupled transcription/translation.
18. Magnesium concentration affects lysate activity, although
the optimum is fairly broad as determined using GFP as a
reporter [4]. Hence, magnesium optimization did not
appear necessary for routine lysate preparation in the
Leishmania system. The magnesium concentration in the
feed solution recipe (22.5 mM) represents a total concen-
tration of 4.5 mM when diluted 1/5 into the final reaction
(an additional 1.5 mM Mg(OAc)2 is contributed by the gel-
filtered lysate itself via the EB buffer). Typical optimum
(final reaction) magnesium concentration is 4–5 mM for
bioreactor-based lysates (using a temperature drop in the
final production cultivation), as measured using unsupple-
mented lysate that was supplemented at the point of reac-
tion with feeding solutions prepared as above but with
altered magnesium content. The magnesium optimum
Production of Eukaryotic Cell-Free Lysate from Leishmania tarentolae 13

using multiple flask cultures (without temperature drop

during cultivation) exhibited maximum activity at 5–7 mM
Mg2+ [4]. Fine-tuning of the reaction magnesium concen-
tration is possible by altering the Mg(OAc)2 concentration
in the concentrated feeding solution (as above) or by add-
ing extra Mg(OAc)2 in the final reaction makeup.
19. pLTE (3,437 bp) contains an AmpR unit, T7 promoter,
pBR322 origin of replication, lac promoter, and an ORF cod-
ing for enhanced GFP (eGFP) flanked by multicloning sites.
Its sequence is shown in Table 4.
20. For C-terminal truncations, engineer Primer R1 to contain
complement to the 3′-end of the desired gene followed by a
stop codon in frame with the gene and random sequence 8
nucleotides in length. The random short sequence is required
to prevent the stop codon from exonuclease digestion.
21. Leishmania cell-free lysate deteriorates rapidly after thawing,
especially if warmed to room temperature or above.
Deterioration occurs at a similar rate whether or not the trans-
lation reaction has been started. Lysate should not be thawed
until as soon as practical before expression.
22. 20 nM represents the approximate saturation value for increas-
ing GFP expression using pLTE plasmid as the vector
backbone.
23. Leishmania extract contains endogenously biotinylated and
fluorescent proteins that in some cases may be difficult to dis-
tinguish from translation products to be detected from
fluorescence.
24. It is perhaps surprising that fluorophores such as eGFP and
mCherry can survive SDS gel electrophoresis provided sam-
ples are not heated (98 °C 10 min completely inactivates both
fluorophores, 70 °C for 10 min is indistinguishable from no
heating at all). If using mCherry as a label and BODIPY®-FL
to label all expressed bands, not heating samples allows gel
scanning for both the mCherry and BODIPY®-FL labels
simultaneously, as shown in Fig. 3. Unfortunately the absence
of heating ensures that the size markers (based on linear DNA)
are inaccurate. One solution is to run all samples as heated/
unheated in separate lanes, with the heated samples (including
BODIPY®-FL) used to accurately size expressed bands and the
unheated samples used to locate fluorophores.
Other documents randomly have
different content
By what prodigy had this house, so simple in appearance, and so like
the rest, avoided the common fate and remained alone, perhaps, of
all the houses of the Chilian plains, calm and tranquil in the midst of
general confusion, equally respected by the two parties contending
for power, and surveying carelessly from the top of its pretty mirador
the revolution raging at its feet, which carried away, as in an infernal
whirlwind, cities, villages, houses, fortunes, and families? This is
what many people, at various periods, had been anxious to know,
though they had never been able to find out. Nobody ostensibly
inhabited this quinta, in which, on certain days, noises were heard
which filled with a superstitious terror the worthy guasos living in the
neighbourhood.
The day after that on which the events occurred which open this
history, the heat had been oppressive, the atmosphere heavy, and
the sun had gone down amidst a flood of purple vapour, the
precursors of a storm which burst with fury as soon as night had
completely closed in. The wind bent down the trees as it whistled
through them, the collision of the branches producing a melancholy
sound; the heavens were black, not a star was to be seen; and large
grey clouds coursed rapidly across the zenith, covering all nature
with a leaden pall. In the distance resounded the howlings of wild
beasts, among which was occasionally mingled the hoarse, sharp
barking of stray dogs.
Nine o'clock struck slowly from a distant steeple; the sound of the
metal, repeated by the echoes from the hills, vibrated with a
plaintive tone over the deserted landscape. The moon, fitfully
emerging from behind the clouds which veiled her, spread for a few
seconds a pale and trembling light over the scene, giving it a
fantastic aspect. This fugitive ray of doubtful light, nevertheless,
enabled a small troop of horsemen, who were painfully ascending a
winding path on the side of a mountain, to distinguish, at a few
paces before them, the black outline of a house, from the top
window of which beamed like a pharos a red, uncertain light. This
house was the "Quinta Verde."
At about four or five paces in advance of the troop rode two
horsemen, muffled carefully in their cloaks, the flaps of their hats
pulled down over their eyes, appeared, in the darkness, to be a
needless precaution; but it, nevertheless, showed that these
personages were very anxious not to be recognized.
"Heaven be praised!" said one of these horsemen to his companion,
as he pulled up his horse, to look searchingly around him, as far as
the darkness would permit; "I hope we shall soon be there."
"In a quarter of an hour, at latest, General, we shall be at the end of
our journey."
"Do not let us stop, then," the one addressed as General said; "I am
impatient to penetrate into this abominable den."
"One moment, General!" the first speaker continued. "It is my duty
to warn your Excellency that there is still time to retreat; and that
would, perhaps, be the more prudent step."
"Please to observe this, Diego," said the General, fixing upon his
companion a look which gleamed in the semi-obscurity like that of a
tiger-cat—"in the circumstances in which I am placed, prudence, as
you understand the word, would be cowardice. I am quite aware
what I am called upon to do by the confidence placed in me by my
fellow citizens; our position is most critical: the liberal reaction is
raising its head in all quarters, and we must put an end to this ever-
reviving hydra. The news of Don Tadeo's escape from death has
spread with the rapidity of a train of gunpowder; all the malcontents
of whom he is the leader, are in almost open action; if I were to
hesitate to strike a great blow and crush the head of the serpent
which hisses in my ears, it would tomorrow, perhaps, be too late;
hesitation has always been the ruin of statesmen in affairs of
importance."
"And yet, General, if the man who has furnished you with this
information should—"
"Be a traitor? Well, that is possible—ay, even probable; therefore, I
have neglected nothing that may neutralize the consequences of a
treachery which I foresee."
"By the Virgin! General, in your place, however—"
"Thank you, old comrade, thank you for your solicitude; but enough
of this subject, you ought to know me well enough to be sure that I
shall never flinch from my duty."
"I have nothing more to do, then, but to wish your Excellency well
through your undertaking; for you know you must arrive alone at the
Quinta Verde, and I can escort you no farther."
"Very well, wait here then; make your men dismount for a time,
keep a sharp watch, and execute punctually the orders I have given
you. I am going on."
Diego bowed respectfully, but with an air of anxiety, and withdrew
his hand, which had been placed on the bridle of the General's
horse. The latter more carefully enveloped himself in his cloak, the
folds of which had become too loose, and gave the usual jockey
signal to excite his horse. At this well-known sound the horse
pricked up its ears, and being thoroughbred, although fatigued, set
off at a gallop.
After a few minutes of this rapid travelling, the General stopped; but
it appeared as if his journey was completed, for, dismounting, he
threw the bridle on his horse's neck, with as little care what became
of it as if it had been a hack post-horse, and walked with a firm step
towards the house, which he had held in view some time, and from
which he was now not more than ten paces distant. This was soon
cleared. When he reached the gate, he stood for a second and
looked around him, as if endeavouring to penetrate the darkness;
but all was calm and silent. In spite of himself, the General was
seized with that vague fear which takes possession of the most
courageous man when in face of the unknown. But General
Bustamente, whom the reader has no doubt recognized, was too old
a soldier to suffer himself to be mastered long by an impression,
however strong it might be; with him this had lasted but an instant,
and he almost immediately recovered his usual coolness.
"What the devil! am I afraid?" he murmured, with an ironical smile,
and going boldly up to the gate, he knocked three times at equal
intervals with the pummel of his sword. In an instant his arms were
seized by invisible hands, a bandage was placed over his eyes, and a
voice, faint as a breath, murmured in his ear—
"Make no resistance, twenty poniards are at your breast; at the first
cry, at the least opposition, you are a dead man. Reply categorically
to our questions."
"All these threats are needless," the General replied, in a calm voice;
"as I came here of my own free will, I can have no intention of
resisting—ask, and I will answer."
"What do you come to seek here?" the voice said.
"The Dark-Hearts."
"Are you ready to appear in their presence?"
"I am," the General replied, still impassive.
"Do you dread nothing?"
"Nothing."
"Let your sword fall."
The General quitted his hold of his sword, and felt at the same
moment that his pistols were taken from him.
"Now, step forward without fear," said the voice.
The prisoner found himself instantly at liberty.
"In the name of Christ, who died upon the cross for the salvation of
the world, Dark-Hearts, receive me among the number of your
brethren!" the General then said, in a low and firm voice.
The double gates of the Quinta Verde flew open before him, and two
masked men, each holding a dark lantern in his hand, the focus of
which he directed on the stranger's face, appeared in the entrance.
"There is still time," said one of the unknown; "if your heart be not
firm, you may retreat."
"My heart is firm."
"Come on, then, as you think yourself worthy to share our glorious
task, but tremble if you have the least intention of betraying us,"
said the masked man, in a deep, sonorous voice.
The General felt, notwithstanding the recklessness of his character, a
cold shudder run through his limbs at these words; but he quickly
surmounted this involuntary emotion.
"It is for traitors to tremble," he replied; "for my part, I have nothing
to fear."
And he boldly stepped into the Quinta Verde, the doors of which
closed after him with a dull, heavy sound. The bandage which
covered his eyes, and which had prevented those who had
interrogated him from recognizing him, notwithstanding their efforts
to do so, was then removed. After proceeding for more than a
quarter of an hour along a circular corridor, lighted only by the red
flickering flame of the torch carried by the guide through this
labyrinth, the General was suddenly stopped by a door in front of
him. He turned hesitatingly towards the masked men, who had
followed him step by step.
"What do you wait for?" said one of them in reply to his mute
interrogation. "Is it not written, Knock and it shall be opened unto
you?"
The General bowed in sign of acquiescence, and knocked loudly at
the door. The folding panels drew back silently into the wall, and the
General found himself at the entrance of a vast hall, whose walls
were covered with long red draperies, gloomily enlightened by a
bronze lamp and several chandeliers suspended from the ceiling,
which shone in an uncertain manner upon the countenances of
about a hundred men, who, with naked swords in their hands, fixed
their eyes upon him through the black masks which concealed their
faces. At the bottom of this hall was a table covered with a green
cloth, at which were seated three men. Not only were those three
men masked, but, as a further precaution, before each of them a
lighted torch was planted on the table, the dazzling flame of which
allowed them to be but vaguely seen. Against the wall was a crucifix,
between two hourglasses surmounted by a death's-head with a
poniard run through it.
The General manifested no emotion at this imposing mise en scène.
A smile of disdain curled his lip, and he stepped boldly forward. At
this moment he felt a light touch on the shoulder, and, on turning
round, perceived that one of the guides was holding out a mask to
him. In spite of the precautions he had taken to disguise his
features, he eagerly seized it, placed it on his face, folded his cloak
round him, and entered.
"In nomine Patris, et Filii, et Spiritus Sancti!" he said.
"Amen!" all present replied, in a sepulchral tone.
"Exaudiat te Dominus, in die Tribulationis," said one of the
personages behind the table.
"Impleat Dominus omnes petitiones tuas," the General replied,
without hesitation.
"La Patria!" the first speaker rejoined.
"O la Muerte!" replied the General.
"What is your purpose in coming here?" the man who up to this time
alone had spoken, asked.
"I wish to be admitted into the bosom of the elect."
There was a momentary silence.
"Is there anyone among us who can or will answer for you?" the
masked man then asked.
"I cannot say; for I do not know the persons among whom I find
myself."
"How know you that?"
"I suppose so, as they, as well as I, are masked."
"The Dark-Hearts," said the interrogator in a deep tone, "consider
not the countenance; they search souls."
The General bowed at this sentence, which appeared to him to
border upon the ridiculous. The interrogator continued:—"Do you
know the conditions of your affiliation?"
"I know them."
"What are they?"
"To sacrifice mother, father, brothers, relations, friends, and myself,
without hesitation, to the cause which I swear to defend."
"What next?"
"At the first signal, whether it be by day or night, even at the foot of
the altar, in whatever circumstance I may be placed, to quit
everything, in order to accomplish immediately the orders that shall
be given me, in whatever manner they may be given, and whatever
may be the tenor of that order."
"Do you subscribe to these conditions?"
"I subscribe to them."
"Are you prepared to swear to submit yourself to them?"
"I am prepared."
"Repeat, then, after me, with your hand upon the Gospels, the
words I am about to dictate to you."
"Dictate!"
The three men behind the table rose; a Bible was brought, and the
General resolutely placed his hand upon the book. A faint murmur
ran through the ranks of the assembly. The president struck the
table with the hilt of his dagger, and silence was re-established. This
man then pronounced in a slow and deep toned voice the following
words, which the General repeated after him without hesitation:—
"I swear to sacrifice myself, my family, my property, and all that I
can hope for in this world, for the safety of the cause defended by
the Dark-Hearts. I swear to kill every man, be he my father, be he
my brother, who shall be pointed out to me. If I fail in my faith, if I
betray those who accept me as their brother, I acknowledge myself
to be worthy of death; and I, beforehand, pardon the Dark-Hearts
who may inflict it upon me."
"So far well!" replied the president, when the General had
pronounced the oath. "You are now our brother."
He then rose, and stepping across the hall, stood full in front of the
General.
"Now," he said in a solemn threatening voice, "answer me, Don
Pancho Bustamente. As you, of your own free will, take a false oath
before a hundred persons, do you think we should commit a crime in
condemning you, since you have had the audacity to place yourself
in our power?"
In spite of his assurance, the General could not repress a start of
terror.
"Remove the mask which covers this man's face, so that everyone
may know that it is he! Ah! General; you have entered the lion's den,
and you will be devoured."
The noise of a distant commotion was heard.
"Your soldiers are coming to your rescue," the president resumed,
"but they will come too late, General; prepare to die!"
These words fell like the blow of a mace upon the brow of him who
found himself thus outwitted; he, nevertheless, did not yet lose
heart; the noise evidently approached; and there could be no doubt
but that his troops, who surrounded the Quinta Verde on all sides,
would soon gain possession of it; all he wanted was time.
"By what right," he said haughtily, "do you constitute yourselves
judges and executioners of your own sentence?"
"You are one of us, and are bound by our sentence," the president
replied, with an ironical smile.
"Beware of what you are about to do, gentlemen," the General
added in a haughty tone; "remember I am minister-at-war!"
"And I am King of Darkness," the president cried in a voice that
froze the very blood of the General; "my dagger is more sure than
the muskets of your soldiers; it does not let its victims escape.
Brethren, what chastisement does this man deserve?"
"Death!" the conspirators replied.
The General saw that he was lost.

CHAPTER XV.

THE DEPARTURE.
Sergeant Diego, when left by General Bustamente a few paces from
the Quinta Verde, was very uneasy regarding the fate of his leader,
and entertained dismal presentiments. He was an old soldier, and
well acquainted with all the machinations and treacheries practised
in this country between inveterate enemies. He had been far from
approving of the General's undertaking, for he knew better than
anyone how little confidence ought to be placed in spies.
Constrained, ostensibly, to obey the order he had received, he had
resolved, in petto, not to leave his leader without help in the wasps'
nest into which he had cast himself headlong. Diego entertained for
General Bustamente, under whose orders he had served ten years, a
profound regard, which entitled him to certain freedoms, and his
entire confidence. He immediately placed himself in relation with two
other officers of the detachment, ordered, like himself, to watch the
mysterious house whose dark outline cut gloomily across the cloudy
sky, and around which there was a close blockade. He was walking
about, biting his moustache, and swearing to himself, determined, if
the General did not come out within half an hour, to obtain an
entrance by force, if necessary, when a heavy hand was laid upon
his shoulder. He turned sharply round, stopping short in an oath that
was passing his lips, and saw a man standing before him: it was Don
Pedro.
"Is that you?" he asked, as soon as he recognised him.
"Myself," the spy replied.
"But where the devil do you come from?"
"No matter; do you wish to save the General?"
"Is he in danger?"
"In danger of death."
"Demonios!" the sergeant shouted; "he must be saved!"
"For that purpose I am here; but don't speak so loud."
"I will speak as you like, provided you will tell me."
"Nothing!" Don Pedro replied, "for there is not a minute to be lost."
"What is to be done?"
"Listen! A detachment must feign an attack upon the gate by which
the General entered; another will watch the environs, for the Dark-
Hearts have roads known only to themselves; you, with a third
detachment, will follow me; I will undertake to introduce you into
the house—is that agreed upon?"
"Perfectly."
"Make haste, then, to inform your colleagues; time presses."
"Instantly; where shall I find you again?"
"Here."
"Very well; I only ask five minutes," and he strode away in haste.
"Hem!" thought Don Pedro, as soon as he was alone; "we should be
prudent when we wish affairs to be profitable; from what I heard,
they will condemn the General, and they must not be allowed to go
as far as that, for my interests would suffer too seriously; I have
manoeuvred so as to be safe from all suspicion; if I succeed, I shall
be more in favour with the General than ever, without losing the
confidence of the conspirators."
"Well!" he said, as he saw Diego coming towards him.
"Everything is done," replied the sergeant, out of breath. "I am
ready."
"Come on, then, and God grant it may not be too late!"
"Amen!" said the soldier.
Everything was done as had been arranged; whilst one detachment
vigorously attacked the gate of the Quinta Verde, Don Pedro led the
troops commanded by Diego to the opposite side of the house,
where a low window was open; this window was grated, but several
bars had been removed beforehand, which left the entrance easy.
Pedro commanded the soldiers to be silent, and they entered the
house one by one. Guided by the spy, they advanced stealthily,
without meeting with obstacles of any kind. At the end of a few
minutes they came to a closed door.
"This is it!" said Pedro, in a low voice.
At a sign from the sergeant, the door was beaten in with the butt
end of their muskets, and the soldiers rushed into the room. It was
nearly empty, its only occupant being a man stretched motionless
upon the floor. The sergeant sprang towards him, but recoiled with a
cry of horror—he had recognised his leader—General Bustamente lay
with a dagger sticking upright in his breast. To the hilt of the dagger
was tied a long black strip, upon which were written these words in
red ink:
"The Justice of the Dark-Hearts!"
"Oh!" cried Diego; "Vengeance! Vengeance!"
"Vengeance!" the soldiers repeated, with rage, mingled with terror.
The sergeant turned round towards Pedro, whom he believed to be
still by his side; but the spy, who alone could guide them in their
researches, had thought it prudent to steal away. As soon as he saw
that what he dreaded had happened, he had disappeared without
anybody observing his departure.
"No matter!" said Diego. "If I demolish this den of assassins, from
bottom to top, and don't leave stone upon stone, I swear I will find
these demons, if they are buried in the centre of the earth."
The old soldier began searching in all directions, whilst a surgeon
who had followed the detachment paid attention to the wounded
man, whom he endeavoured to restore to his senses.
The Dark-Hearts, as the spy had truly said, had paths known only to
themselves, by which they had quietly departed, after having
accomplished their terrible vengeance, or executed their severe
justice, according to the point of view in which an act of this nature
and importance is viewed. They were already far off in the country,
safe from all danger, while the soldiers were still ferociously
searching for them in and about the house.
Don Tadeo and Don Gregorio returned together to the chacra, and
were astonished, on their arrival, to find Valentine, whom they
supposed to be in bed and asleep long before, waiting for them at
that late hour, to request a few minutes' conversation. In spite of the
very natural surprise which the demand at such a singular hour
excited, the two gentlemen, who supposed the Frenchman had
serious reasons for acting thus, granted his request, without making
the least observation. The conversation was long—so long, that we
think it useless to repeat it here in detail, but will satisfy ourselves
with giving our readers the end of it, which sums it up perfectly.
"I will not insist," said Don Tadeo, "although you will not tell us your
motives. I believe you to be too considerate a man, Don Valentine,
not to be convinced that the reasons which force you to leave us are
serious."
"Of the greatest seriousness," the young man replied.
"Very well. But on leaving this place, in which direction do you
intend to bend your steps?"
"Faith! I own frankly—besides, you know already that I and my
friend are in search of fortune—that all directions are the same to
us, since we must, above everything, depend upon chance."
"I am of your opinion," replied Don Tadeo, smiling. "Listen to me,
then. I possess large estates in the province of Valdivia, which it is
my intention to visit shortly. What prevents you going that way in
preference to any other?"
"Nothing, that I know of."
"I, at this moment, stand in need of a man whom I can depend
upon, to undertake an important mission into Araucania, to one of
the principal chiefs of the people of that country. If you are going to
the province of Valdivia, you will be obliged to traverse Araucania in
its whole length. Are you willing to undertake this commission? Will
that inconvenience you?"
"Why should I not?" said Valentine. "I have never come face to face
with savages; I should like to see what sort of people they are."
"Very well; now is your opportunity. That is agreed upon then. You
wish to start tomorrow, do you not?"
"Tomorrow! Today, if you please—in a few hours, for it will not be
long before the sun will be up."
"That is true. Very well, then; at the moment of your departure, my
major-domo shall place, on my part, written instructions in your
hands."
"Caramba!" said Valentine, laughing; "here am I transformed into an
ambassador!"
"Do not joke, my friend," said Don Tadeo, seriously. "The mission I
confide to you is delicate—dangerous, even; I do not conceal that
from you. If the papers of which you will be the bearer are found
upon you, you will be exposed to great dangers. Are you still willing
to be my emissary?"
"Pardieu! Wherever there is danger there is pleasure. And what is
the name of the person to whom I am to remit these despatches?"
"They are of two descriptions. The latter only concerns yourself;
during the course of your journey you can make yourself acquainted
with them; they will instruct you in certain matters you should know
in order to secure the success of your mission."
"I understand—and the others?"
"The others are for Antinahuel, that is, the Tiger Sun, and must be
delivered into his own hands."
"A queer name that!" Valentine replied, with a laugh. "And where am
I to find the gentleman rejoicing in such a formidable title?"
"By my faith, my friend," replied Don Tadeo, "I know no more than
you do."
"The Araucano Indians," interrupted Don Gregorio, "are a rather
wandering race, and it is sometimes difficult to find the one you are
in search of."
"Bah! I shall find him, be assured of that."
"We do entirely rely upon you."
"In a few hours, as I have told you, I shall myself set out to place in
a convent in Valdivia the young lady whom you so fortunately saved;
it will, therefore, be in Valdivia I shall await your answer."
"I beg your pardon, but I have not the least idea where Valdivia is,"
observed Valentine.
"Don't be uneasy on that account; any child in this country can
direct you the way thither," Don Gregorio replied.
"Thanks."
"And now, if you change your mind when we meet again, and
consent to remain among us, remember we are brothers, and do not
hesitate to inform me of your new determination."
"I can neither, reply yes or no, sir; if it depended upon me, we
should continue to see each other frequently."
After exchanging a few more friendly expressions, the three men
separated. At sunrise, Louis and Valentine, mounted on magnificent
horses, which Don Tadeo had forced them to accept, rode away
from the chacra, followed by Cæsar. Valentine had received his
despatches from the hands of the major-domo. As they were
quitting the farm Louis turned round instinctively, as if to salute with
a last look a spot he abandoned for ever, and which contained all
that was dear to him. A window was gently opened, and the face of
the fair girl appeared through the small interval, bathed in tears. The
two young men bowed respectfully towards the necks of their
horses, and with a deep sigh from Louis, they moved on as the
window closed.
"Adieu! oh, adieu for ever!" murmured Louis, choking with emotion.
"Ah, perhaps!" said Valentine; and, to rouse his friend from his grief,
he put his horse into a gallop, and they soon lost sight of the chacra
in the windings of the road.
Within four hours from their departure Don Tadeo and Don Gregorio
likewise set out on their journey to Valdivia, for the purpose of
placing Doña Rosario in the convent. But the enemy of whom they
thought they had relieved themselves at the Quinta Verde, was not
dead; the dagger of the King of Darkness had not proved more sure
than the bullets of the General. The two enemies were destined
soon to meet again. Notwithstanding the seriousness of the wound
he had received, thanks to the intelligent cares lavished upon him,
but more particularly, thanks to his excellent constitution, General
Bustamente was soon in a convalescent state. Don Pancho and the
Linda, from that time united by the strongest of ties—a common
personal hatred—prepared to take their revenge upon Don Tadeo,
and that of the bitterest nature. The General signalized his
restoration to health by cruelties of the most flagrant kind towards
every man suspected of liberalism, and by inaugurating throughout
the republic a pitiless system of terror. Don Tadeo was pronounced
outlawed; his friends were cast into dungeons, and their property
was confiscated; and then, when the General thought that all these
vexations must bring his enemy to bay, and he had nothing to dread
from him or his partizans, under the pretence of visiting the
provinces of the Republic, he set out for Valdivia, accompanied by
his mistress.

CHAPTER XVI.

THE MEETING.
As the principal incidents of this history are now about to take place
in Araucania, we think it necessary to give our readers some account
of this people, who alone of all the nations the Spaniards
encountered in America, succeeded in resisting them, and had, up to
the time we treat of, preserved intact their liberty and almost all
their territory. The Araucanos or Moluchos inhabit the beautiful
country situated between the rivers Biobio and Valdivia, having on
one side the sea, and on the other the great Cordilleras of the
Andes. They are thus completely enclosed within the Chilian
republic, and yet, as we have said, have always remained
independent. It would be a great error to suppose these Indians
savages. The Araucanos have adopted as much of European
civilization as suited their character and their mode of living, and
have rejected the rest. From the most remote times these peoples
had formed a national body, strong and compact, governed by wise
laws rigorously executed. The first Spanish conquerors were quite
astonished to find in this remote corner of America, a powerful
aristocratic republic, and a feudalism organized almost upon the
same plan as that which prevailed in Europe in the thirteenth
century. We will here enter into a few details of the government of
the Araucanos, who proudly style themselves Aucas—free men.
These details concerning a people too little known, up to this day,
cannot fail to interest the reader.
The principal chiefs of the Araucanos are the Toquis,[1] the Apo-
Ulmens, and the Ulmens. There are four Toquis, one for each
territorial division; they have under their orders the Apo-Ulmens,
who, in their turn, command the Ulmens. The Toquis are
independent of each other, but confederated for the public good.
Titles are hereditary, and pass from males to males. The vassals or
Mosotones are free; in time of war alone they are subject to military
service; but, in this country, and it is this which constitutes its
strength, every man in a condition to bear arms is a soldier. It may
easily be understood what the chiefs are when we state that the
people consider them only as the first among their equals, and that
their authority is consequently rather precarious; and if, now and
then, certain Toquis have endeavoured to extend their authority, the
people, jealous of their privileges, have always found means to keep
them within the bounds prescribed by their ancient usages.
A society whose manners are so simple, and interests so little
complicated, which is governed by wise laws, and all the members
of which have an ardent love of liberty, is invincible, as the Spaniards
have many times found to their cost. After having, in several
attempts, endeavoured to subdue this little corner of land, isolated
amidst their own territory; they have ended by acknowledging the
futility of their efforts, and have tacitly admitted their defeat by
renouncing for ever their projects of obtaining dominion over the
Araucanos, with whom they have contracted alliances, and across
whose territory they now peacefully pass on their road from
Santiago to Valdivia.
The Carampangue—in the Araucano idiom, refuge of lions—is a
charming stream, half torrent, half river, which comes bounding
down from the inaccessible summits of the Andes, and, after many
capricious windings, loses itself in the sea two leagues to the north
of Arauco. Nothing can be more beautiful than the banks of the
Carampangue, bordered by smiling valleys, covered with woods,
with apple trees loaded with fruit, rich pastures in which animals of
all kinds range and feed at liberty, and high mountains, from the
verdant sides of which hang, in the most picturesque positions,
clusters of cabins, whose whitewashed walls shine in the sun, and
give life to this enchanting landscape.
On the day when we resume our narrative, that is, on a beautiful
morning in July—called by the Indians the month of the sun—two
horsemen, followed by a magnificent black and white Newfoundland
dog, were ascending, at a sharp trot, the course of the river,
following what is called a wild beast's track, scarcely marked in the
high grass. These men, dressed in the Chilian costume, surging up
suddenly amidst this wild natural scene, formed, by their manners
and their vestments, a contrast with everything which surrounded
them; a contrast of which they probably had no idea, for they rode
as carelessly through this barbarous country, abounding in perils and
ambushes without number, as they would have done along the road
from Paris to Saint-Cloud. These two men, whom the reader has, no
doubt, recognized, were the Count Louis de Prébois-Crancé and
Valentine Guillois, his foster brother. They had passed in turn
through Maulé, Talca, and Concepción; and on the day we meet
them again, in the middle of Araucania, they had been full two
months on the road, travelling philosophically along with their dog
Cæsar upon the banks of the Carampangue. This was the 14th of
July, 1837, at eleven o'clock in the morning.
The young men had passed the night in an abandoned rancho which
they had fallen in with on their way, and at sunrise resumed their
journey; so that they now began to be sensible of the calls of
hunger. Upon taking a survey of the spot where they found
themselves, they perceived a clump of apple trees, which
intercepted the rays of the sun, and offered them a shelter for their
repast and a little rest. They dismounted and sat down at the foot of
a large apple tree, leaving their horses to browse upon the young
branches so abundant around them. Valentine knocked down a few
apples with a stick, opened his alforjas—large cloth pockets placed
behind the saddle—drew out some sea biscuit, a piece of bacon, and
a goat's milk cheese, and the two young men began eating gaily,
sharing their provisions with Cæsar in a brotherly way, whilst he,
seated gravely in front of them, followed with his eyes every morsel
they put into their mouths.
"Caramba!" said Valentine, with a satisfied smile; "it is comfortable
to have a little rest, after having been on horseback from four
o'clock in the morning."
"Well, to tell the truth, I must own I am a little fatigued," Louis
confessed.
"My poor friend, you are not, as I am, accustomed to long journeys.
It was stupid of me not to remember that."
"Bah! on the contrary, I am getting accustomed to them very well;
and besides," he added, with a sigh, "physical fatigue makes me
forget——"
"Ah! that's true," Valentine interrupted; "come! I am happy to hear
you speak thus—I see you are becoming a man!"
Louis shook his head sorrowfully.
"No," he said, "you are mistaken. As the malady which undermines
me is without remedy, I endeavour to play a manly part."
"Yes, hope is one of the supreme illusions of love; when it can no
longer exist, love dies."
"Or he who experiences it," said the young man, with a melancholy
smile.
This was followed by a silence, which Valentine at length broke.
"What a charming country!" he cried, with feigned enthusiasm, for
the purpose of giving the conversation another direction, as he
swallowed, with delectation, an enormous piece of bacon.
"Yes, but the roads are very bad."
"Who knows?" said Valentine, with a smile: "they say the roads to
Paradise are of that kind; this may be the way thither." Then
addressing the dog, "And you, Cæsar, what do you think of our
journey, old boy?"
The dog wagged his tail, fixing his eyes, sparkling with intelligence,
upon the speaker's face, whilst he eagerly devoured all that was
given to him. But he stopped suddenly in his masticating operations,
pricked up his ears, turned his head sharply round, and balked
furiously.
"Silence, Cæsar!" said Valentine; "what do you bark in that manner
for? You know right well we are in a desert, and that in a desert
there is nobody but the devil!"
But Cæsar continued to bark without heeding his master.
"Hum!" said Louis, "I do not agree with you; I think that the deserts
of America are thickly peopled."
"Well, perhaps you are right."
"The dog's barking is not usual; we ought to take precautions."
"I will see," said Valentine; and addressing the Newfoundland,
"Come! come! hold your tongue, Cæsar! You are tiresome! What's
the matter with you? What teases you? Do you scent a stag?
Caramba! That would be a glorious godsend for us."
Here he rose, and cast an inquiring glance around, but he
immediately stopped, and seized his rifle, making a sign to Louis to
do the same, in order to be prepared for whatever might happen.
"Diable!" he said, "Cæsar was right, and I must confess myself a
stupid fellow. Look yonder, Louis!"
The other turned his eyes as directed.
"Oh! oh!" he said; "what is this?"
"Hum! I believe we shall soon discover."
"With God's help!" Louis replied, cocking his rifle.
Ten Indians in war costume, and mounted on magnificent horses,
were drawn up within twenty paces of the travellers, though the
latter were quite unable to comprehend how they had succeeded in
approaching so near to them without being discovered.
Notwithstanding Valentine's efforts, Cæsar continued to bark
furiously, and endeavoured to rush upon the Indians. The American
warriors, motionless and impassible, made neither gesture nor
movement, but they surveyed the Frenchmen so closely and
persistently, that Valentine, not very patient in his nature, began to
find himself excessively annoyed.
[1] This word comes from the verb toquin, which means to judge,
to command.

CHAPTER XVII.

THE PUELCHES.
"Eh! eh!" said Valentine, whistling sharply to his dog, who
immediately came to him; "these fellows do not seem to have
friendly intentions; we must be upon our guard: who knows what
may happen?"
"They are Araucanos," said Louis.
"Do you think so? Then they are devilish ugly!"
"Well, now, for my part, I think them very handsome."
"Ah, yes; that may be in an artistic point of view. But, ugly or
handsome, we will await their coming."
The Indians talked among themselves, and continued to look at the
young men.
"They are consulting to determine with what sauce they shall eat
us," said Valentine.
"Not at all——"
"Bah! I tell you they are."
"Pardieu! they are not cannibals!"
"No? So much the worse; that's a defect. In Paris, all the savages
exhibited in public are cannibals."
"You madman! you laugh at everything."
"Would you prefer my weeping a little? It appears to me that at this
moment our position is not so seducing in itself that we should seek
to make it more dismal."
These Indians were for the most part men of from forty to forty-five
years of age, clothed in the costume of the Puelches, one of the
most warlike tribes of Upper Araucania; they wore the poncho
floating from the shoulders, the calzoneras fastened round the hips
and falling to the ankle, the head bare, the hair long, straight, and
greasy, gathered together by a red ribbon, which encircled the brow
like a diadem, and the face painted of various colours. Their arms
consisted of a long lance, a knife, a gun hanging from the saddle,
and a round buckler, covered with leather, ornamented with
horsehair and human scalps.
The man who appeared to be their chief was a man of lofty stature,
expressive features, hard and haughty, but still displayed a certain
frankness, a very rare quality among Indians. The only thing which
distinguished him from his companions was a feather of the eagle of
the Andes, planted upright on the left side of his head, in the bright
red ribbon that confined his hair.
After having consulted with his companions for a few minutes, the
chief advanced towards the travellers, making his horse curvet with
inimitable grace, and lowered the point of his lance in sign of peace.
When within three paces of Valentine, he stopped, and, after
saluting him ceremoniously, in the Indian fashion, by placing his
right hand on his breast, and slowly bowing his head twice, he said
to him in Spanish:—
"My brothers are Muruches—foreigners,—and not Culme-Huinca—
despicable Spaniards. Why are they so far from the men of their own
nation?"
This question, asked in the guttural accent, and with the emphatic
tone peculiar to the Indians, was perfectly understood by the young
men, who, as we have before observed, generally spoke Spanish
themselves.
"Hum!" Valentine said to his companion, "here is a savage who
appears to have a little curiosity about him—what think you?"
"Bah!" Louis replied, "answer him, at all events that will do no
harm."
"Why, no, that is true; we cannot easily be more compromised than
we are already."
And turning towards the chief, who waited impassibly,
"We are travelling," he said, laconically.
"What! alone, thus?" asked the chief.
"Does that astonish you, my friend?"
"Do my brothers fear nothing?"
"What should we fear?" said the Parisian in a bantering tone. "We
have nothing to lose."
"What! not even your hair?"
Louis could not refrain from laughing, as he looked at Valentine.
"Ah! ah! what, he is laughing at the disordered state of my hair, is
he, the ugly wretch?" Valentine grumbled, vexed at the observation
of the chief, and quite mistaking his intentions. "Stop a bit!" then he
added, in a loud voice, "Have the goodness to pass on, gentlemen
savages. Your remarks are not pleasant, I can assure you."
He cocked his rifle, and lifted it to his shoulder, as if taking aim at
the chief. Louis, who had attentively followed the progress of the
conversation, without saying a word imitated the action of his friend,
directing the barrel of his rifle towards the group of Indians. The
chief had, doubtless, understood but little of the speeches of his
adversaries, but far from appearing terrified at the menacing attitude
they assumed, he seemed to contemplate with pleasure the martial
and firm deportment of the Frenchmen; and putting gently on one
side the weapon pointed against his breast, said in a conciliatory
tone:
"My friend is mistaken. I have no intention of insulting him. I am his
penni—brother—and his companion's likewise. Were not the
palefaces eating when I and my young men came up?"
"Faith! yes, chief, you say true," interrupted Louis, with a smile;
"your sudden appearance stopped the progress of our humble
repast."
"Part of which is very much at your service," continued Valentine,
pointing with his finger to the provisions spread upon the grass.
"I accept your offer," said the Indian, cordially.
"Bravo!" cried Valentine, throwing down his rifle, and preparing to
resume his seat on the grass; "to table, then!"
"Yes," replied the chief, "but upon one condition."
"What is that?" the young men asked together.
"That I shall furnish my part."
"Agreed," said Louis.
"Well, that is but fair," Valentine added; "and it will be the more
acceptable, from our not being rich, and having but meagre fare to
offer you."
"The bread of a friend is always good," the chief said, sententiously.
"That is admirably answered! But, at this moment, unfortunately, our
bread is only stale biscuit."
"I will remedy that;" and the chief said a few words in the Molucho
language to his companions, who began to rummage in their
alforjas, and quickly produced maize tortillas, some charqui, and
several leathern bottles filled with chica—a sort of cider made of
apples and Indian corn. The whole was placed upon the grass before
the two Frenchmen, who were wonderstruck at the sudden
abundance which had succeeded without any transition to their late
short commons. The Indians dismounted, and sat down in a circle
round the travellers. The chief, then turning towards his guests, said
with a pleasant smile—
"Now, then, let my brothers eat."
The young men did not require the cordial invitation to be repeated,
but vigorously attacked the provisions so frankly offered. For the first
few minutes silence prevailed among the party, for all were too well
engaged to talk; but as soon as appetite was a little appeased,
conversation was resumed.
Of all men, Indians, perhaps, understand the laws of hospitality the
best. They have an instinct of social conventions, if such an
expression may be allowed, which makes them divine at once, with
infallible correctness, what the questions are that may be properly
addressed to their guests, and the point at which they should stop to
avoid committing any indiscretion. The two Frenchmen, who for the
first time found themselves in contact with Araucanos, could not
overcome the surprise caused by the knowledge of life, and the
noble and frank manners of these men, whom, on the faith of
accounts more or less false, they were accustomed, in common with
all Europeans, to consider as gross savages, almost destitute of
intelligence, and quite incapable of any delicacy of behaviour.
"My brothers are not Spaniards?" the chief said, half interrogatively.
"That is true," Louis replied; "but how did you discover that?"
"Oh!" he said, with a disdainful smile, "we are well acquainted with
those chiaplos—wicked soldiers. They are too old enemies to allow
us to commit an error with regard to them. From what island do my
brothers come?"
"Our country is not an island," Valentine observed.
"My brother is mistaken," the chief said emphatically; "there is but
one country that is not an island, and that is the great land of the
Aucas."
The two young men bowed their heads before an opinion so
peremptorily put forth—all discussion became impossible.
"We are Frenchmen," Louis replied.
"Frenchmen! ah! a good brave nation! We had several French
warriors in the time of the great war."
"What!" said Louis, with excited curiosity, "have French warriors
fought with you?"
"Yes," the chief remarked, proudly; "warriors with grey beards, and
breasts marked with honourable scars, which they received in the
wars of their island, when they fought under the orders of their
great chief, Zaléon."
"Napoleon?" said Valentine, quite astonished.
"Yes; I believe it is so the palefaces pronounce his name. Did my
brother know him?" the chief added, with ill-concealed curiosity.
"No," replied the young man. "Although born in his reign, I was
never able to get sight of him, and he is now dead."
"My brother is mistaken," said the Puelche, solemnly; "such warriors
as he do not die. When they have performed their task upon earth
they go to Paradise—to hunt with Pillian, the master of the world."
The young men bowed, as if convinced.
"It is very singular," said Louis, "that the reputation of that powerful
genius should have spread to the most remote and unknown regions
of the globe, and be preserved pure and brilliant among these rude
men; whilst in that France, for which he did everything men
invariably seek to lessen it, and even to destroy it."
"Like all their compatriots, who, from time to time, traverse our
hunting grounds, our brothers have, doubtless, trading purposes in
coming among us. Where are your goods?" said the chief.
"We are not traders," replied Valentine; "we came to visit our
brothers, the Araucanos, of whose wisdom and hospitality we have
heard much."
"The Moluchos love the French," the chief said, flattered by the
compliment; "my brothers will be well received in our villages."
"To what tribe does my brother belong?" asked Valentine, inwardly
delighted at the good opinion the Indians entertained of his
compatriots.
"I am one of the principal Ulmens of the sacred tribe of the Great
Hare," the chief said, proudly.
"Thank you—one word more."
"Let my brother speak; my ears are open."
"We are in search of a Molucho chief, to whom we have a message
from a friend of his, with whom he has had much dealing."
"What is the chief's name?"
"Antinahuel."
"Good!"
"Does my brother know him?"
"I know him. If my brothers will follow me they shall see the toldo of
a chief in which they shall be received like pennis. When they have
rested, if they desire it, I will myself conduct them to Antinahuel, the
most powerful Toqui of the four Uthal-Mapus of the Araucano
confederacy."
"What province is governed by Antinahuel?"
"The Piré-Mapus, that is to say, the interior of the Andes."
"Thanks, brother."
"Will my brothers accept the offer I have made them?"
"Why should we not accept it, chief, if, as I believe, it is made in
earnest?"
"Let my brothers come, then," the chief said, with a smile; "my
toldería is not far off."
The breakfast was over, and the Indians were mounting.
"We may as well go," said Valentine, in French. "This Indian appears
to speak cordially and honestly, and it will give us a capital
opportunity of studying interesting manners and customs. What do
you think, Louis?—It may prove very amusing."
"Well, I see no harm that accepting the invitation can do."
"God speed us, then!"
And with a bound he was in his saddle, imitated by Louis.
"Forward!" cried the chief, and the party set off at a gallop.
"Well, it must be allowed," said Valentine, in his cheerful way, "that
these savages, if savages they are, have some redeeming qualities
belonging to them. I begin to take a warm interest in them. They
are true Scotch mountaineers for hospitality. I wonder what my
regimental comrades, and more particularly my old friends of the
Boulevard du Temple, would say if they could see me now! Houp!
After me, the end of the world!"
Louis laughed at this outburst of the incorrigible gamin, and, without
further inquiries, the young men gaily abandoned themselves to the
guidance of their new friends, who, after leaving the banks of the
river, directed their course towards the mountains.

CHAPTER XVIII.

THE BLACK JACKAL.

In order to make the facts which follow intelligible, we are obliged
here to relate an adventure which happened more than twenty years
before the period at which our history commences.
Towards the end of the month of December, 1816, on a cold, rainy
night, a traveller, mounted on an excellent horse, and carefully
wrapped in the folds of an ample cloak, was following at a round trot
the road, or rather the blind path, on the mountains which leads
from Cruces to San-José. This man was a rich landowner, who was
making a journey into Araucania, for the purpose of treating with the
Indians for a large number of cattle and sheep. Having left Cruces
about two o'clock in the afternoon, he had been delayed on his way
by settling some business with various guasos, and he was
hastening to gain a hacienda he possessed at some leagues from
the spot where he then was, and where he reckoned upon passing
the night.
The country at the time was not in a state of tranquillity. For several
days past the Puelches had appeared in arms upon the frontiers of
Chili, and made incursions into the territories of the republic, burning
the chacras, and carrying off the families they surprised. These
marauders were commanded by a chief named The Black Jackal,
whose cruelty spread terror among the people exposed to his
depredations.
It was, therefore, with some anxiety, mixed with secret
apprehensions, that the man we have spoken of made all speed
along the desolate road which led to his hacienda. Every minute only
added to his fears. The storm, which had threatened all day, burst
forth at last with a fury of which we have no conception in our
climates. The wind roared loudly through the trees, bending some,
and uprooting others. The rain fell in torrents, and the lightning
became so vivid, that the horse began to plunge and rear, and
refused to advance. The rider spurred the restive animal, and
endeavoured, as well as the darkness would permit, to discover
whereabouts he was. After surmounting immense difficulties, he saw
at length, in the distance, the shadow of the walls of his hacienda,
and the lights which shone like guiding stars, when suddenly his
horse bounded on one side in such a way as almost to unseat him.
When, with much trouble, he had recovered his command of the
animal, he looked round to see what could have frightened it so, and
perceived, with terror equal to the horse's, several men of sinister
appearance standing motionless before him. The horseman's first
movement was to seize his pistols, in order to sell his life as dearly
as he could, for he had no doubt he had fallen into an ambuscade of
bandits.
"Keep your hands from your weapons, Don Antonio Quintana," said
a rough voice; "we desire neither your life nor your money."
"What do you want then?" he replied, in a tone that showed he was
a little reassured by that frank declaration, though he still kept on
the defensive.
"Hospitality for this night, in the first place," said the other.
Don Antonio endeavoured to ascertain if he knew the man who was
speaking to him, but he could not distinguish his features through
the darkness.
"The doors of my dwelling always fly open to the stranger," he
remarked; "why have you not knocked at them?"
"Knowing you must come this way, I preferred waiting for you."
"What else do you desire of me, then?"
"I will tell you under your own roof; the open road is a place ill
adapted for imparting confidence."
"If you have nothing more to say to me now, and are as willing as I
am to get under shelter, we will continue our journey."
"Go on, then; we will follow you."
Without exchanging another word, they directed their course
towards the hacienda. Don Antonio Quintana was a resolute man, as
the manner in which he had replied to the men who had so rudely
barred his passage proved him. In spite of the fluency with which
the one who had spoken employed the Spanish language, he had, at
the first word, by his guttural accent, perceived he was an Indian;
and with him fear had immediately given way to curiosity, and he
had not hesitated to grant the hospitality asked, knowing that the
Araucano, Puelches, Hueliches, or Moluchos, never violate the roof
under which they are welcomed, and that the hosts who shelter
them are held sacred.
On arriving at the hacienda, Don Antonio found he was not
mistaken; the men who had accosted him in so strange a manner
were really Indians. There were four of them, and with them was a
young woman with a child at the breast. The hacendero welcomed
them to his dwelling with all the minute forms of Castilian courtesy,
and gave orders to his peones or Indian domestics, terrified at the
savage appearance of the strangers, to assist them with everything
they might desire.
"Eat and drink," he said, "you are at home, here."
"Thanks!" replied the man, who had till that time been spokesman.
"We accept your offer with as good a will as you give it, as far as
regards food, of which we stand most in need."
"Will you not rest till day?" asked Don Antonio; "the night is dark,
and the weather frightful for travelling."
"A black night is what we desire; besides, we must depart
immediately. Now, allow me to put my second request to you."
"Explain yourself," said the Spaniard, examining the speaker
attentively.
The latter was a tall, well-made man, of about forty; his strongly-
marked features and his commanding eye proclaimed that he was
accustomed to exercise authority.
"It was I," he said, without preamble, "who directed the last invasion
made upon the palefaces of the frontiers. My mosotones were all
killed yesterday in an ambuscade by your lanceros; the three you
see with me are all that remain of a troop of two hundred warriors;
Welcome to our website – the ideal destination for book lovers and
knowledge seekers. With a mission to inspire endlessly, we offer a
vast collection of books, ranging from classic literary works to
specialized publications, self-development books, and children's
literature. Each book is a new journey of discovery, expanding
knowledge and enriching the soul of the reade

Our website is not just a platform for buying books, but a bridge
connecting readers to the timeless values of culture and wisdom. With
an elegant, user-friendly interface and an intelligent search system,
we are committed to providing a quick and convenient shopping
experience. Additionally, our special promotions and home delivery
services ensure that you save time and fully enjoy the joy of reading.

Let us accompany you on the journey of exploring knowledge and

personal growth!

ebookname.com